mail2web.com Blog

Have you been hacked?


April 6th, 2004


By GadgetManiac

No, not your system, but rather, you personally. A new novel entitled “Smart Genes” by Rick Heller made me realize that I have not taken a backup of myself.

The novel concerns a group of grad students who hack other people’s DNA for fun and profit…a petty thief becomes a super-criminal through unscrupulous genetic manipulation, etc. This got me thinking about the fact that I have no reference baseline with which to compare my current self in order to ascertain whether or not I have personally been hacked or modified.

So, here are some gadgets for creating a backup of yourself:

The cheek swab seems to be the easiest and cheapest way to create a long-term record of your DNA. Send away for the collection kit from a number of companies, here’s one of them. Take a sample of your DNA & return it for preparation. Cost is about $14.95. Good for maybe 50 years. Fyi, here are 27 other ways to profile your DNA.

Ok, now let’s say that you discover that you have indeed been hacked!…now what? Basically, you have a huge problem. The bad news is that, unlike computer systems, the restore procedure for people is not nearly as advanced as the backup. You’re looking at things like transfection, which is nicely described at this link. But more on this at a later date.

joke on The doctor says: I have some good news & some bad news. The good news is that we’ve finally been able to find the DNA for your brain; its “GTTACCGTGACCTCAGTCAATG…”. The patient says: Great, so what’s the bad news? Doctor says: your DNA decodes as “this space intentionally left blank” /joke off/

Not interested in DNA? Well, if you don’t like the way the novel is written, then maybe you can help (re-)write it. Rick Heller is looking for co-authors to improve his book…an exercise in asynchronous collaborative authoring.

Share and Enjoy:
  • TwitThis
  • Digg
  • StumbleUpon
  • del.icio.us
  • Slashdot
  • Facebook
  • Technorati
  • Google Bookmarks
  • LinkedIn
  • FriendFeed
  • Sphinn
  • SphereIt
  • NewsVine
  • Reddit

Related posts:

  1. Star Trek: Enterprise
  2. Nicosphere Smoking System
  3. The Large Hadron Collider
  4. CNN’s Top 25: Innovations
  5. LCD vs. Plasma, again

Categories: General ~ ~ Trackback

Leave a Reply

Microsoft Gold PartnerBlackBerry AllianceClick to verify BBB accreditation and to see a BBB report. RatePoint Site Seal